Lesch–Nyhan syndrome (LNS) is an X-linked recessive disorder caused by a mutation in the
In this report, we present the case of a LNS patient undergoing cheiloplasty of the lower lip due to self-mutilation and extraction of the left deciduous maxillary canine. To the best of our knowledge, this is the first case report of oral and maxillofacial surgery in LNS in Korea.
A 7-year-old boy with LNS and spastic dystonia was referred to Department of Oral and Maxillofacial Surgery at our hospital to treat self-mutilation of the lower lip. The medical history was as follows: When the patient was a 5 months old, his parents brought him to the department of pediatric neurology with a chief complaint of “he can’t hold his head up.” Laboratory tests revealed an increased serum uric acid level of 9.2 mg/dL. Based on genetic testing, HPRT1 deficiency confirmed the diagnosis of LNS. He started biting his left knuckle at five years of age, and began self-mutilating his lips and buccal mucosa at the age of six, causing lacerations and ulcerations of the oral and perioral soft tissue. The patient was administered allopurinol to treat uric acid overproduction. The patient has since continued to suffer from compulsive lip biting and buccal mucosa scratching, which left multiple scars on his lower lip.(Fig. 1)
Dental history was as follows: At the age of six, an alginate impression was taken to create a lip bumper under sedation with chloral hydrate syrup. The primary maxillary right canine and maxillary left central incisor were extracted at that time due to compulsive self-mutilation of the lower lip. After the lip bumper was placed, lip biting was significantly reduced. In addition to the oral device, multiple medications such as baclofen, clonzaepam, diazepam, and gabapentin were prescribed to manage LNS-associated anxiety, dystonia, and spasticity. However, the left maxillary deciduous canine erupted and the patient continued to bite his lower lip, causing deformation. A lower lip bumper was fabricated and fixed with metal bands to both first molars.
Under general anesthesia, bumpy and fibrotic scar tissue in the lower lip was removed with electrocautery.(Fig. 2) Primary closure was successfully achieved. The left deciduous canine was extracted with dental forceps. Good healing was observed one week after surgery.(Fig. 3)
Genomic DNA was extracted from peripheral blood leukocytes using a QIAmp DNA blood kit (Qiagen). Polymerase chain reaction (PCR) amplification was performed for all coding exons and their adjacent intron boundaries of the
For patients with LNS, different methods have been used to reduce self-mutilating behaviors2-5,12.(Table 2) Restraints, behavioral treatment, psychoactive medications, intrathecal baclofen pump and deep brain stimulation have produced variable results for managing self-mutilation in LNS3. Also, different trauma-preventing intraoral devices have been designed and fabricated to deflect tissues away from the teeth1, which promotes healing of injured tissues while permitting normal jaw movement. According to Arhakis et al.2, a maxillary appliance with an bite raising occlusal plate helped a patient with LNS to stop biting their lips and tongue. Traumatic lesions had resolved completely within 4 weeks post-insertion1.
Cauwels and Martens4 demonstrated that positive behavioral modification could be achieved by a combination of a mouth guard in the upper jaw and a lip-bumper in the lower jaw. If self-mutilating behavior is not responsive to behavioral modification, oral devices and/or medications, patients may require extraction of the primary teeth. In this patient, a lower lip bumper was fabricated at the age of six at the department of pediatric dentistry. The lower lip bumper reduced but did not eliminate biting of the lower lip. The four upper anterior teeth were extracted serially when they erupted. A recent lower lip injury and scar were created after eruption left deciduous maxillary canine tooth. During lower lip revision, #63 was extracted.
Since botulinum toxin (BTX) has been used for pathologies manifested by abnormal, excessive, or inappropriate muscle contraction, BTX has also been applied to patients with LNS7. According to Gilbert et al.3, BTX injection into the bilateral masseter and temporalis muscles demonstrated significant improvement in speech and reductions in self-mutilating behavior. In addition to masticatory muscles, Garcia-Romero et al.7 injected BTX into the biceps brachii to reduce self-mutilation in patients with LNS. It was a useful and safe method to reduce self-biting behavior and prevent biting their hands or arms or using their arms7. The same authors7 recommended high doses of BTX on a regular basis to obtain good results. According to Gutierrez et al.12, small doses of BTX injection in the facial muscles including zygomatic, lip orbicularis and lip mentalis muscles are useful to prevent self-mutilation. In the patient in the current case, BTX injection was delayed. Injection is planned for when lip-biting is aggravated.
The underlying cause of LNS needs to be better understood in order to provide more effective treatment1. Different therapeutic modalities are necessary to prevent self-mutilating behavior. In oral and maxillofacial surgery, surgeons should consider extraction of permanent teeth when patients persist with self-mutilation. In addition, BTX injections in masticatory and facial muscles can be helpful to reduce self-biting behavior and control dystonia. LNS patients with lip deformities due to persistent lip biting may require scar revision.
H.I.P. wrote the manuscript. K.M.A. designed the report and helped to draft the manuscript. G.H.K. performed the genetic analysis. All authors read and approved the final manuscript.
Written informed consent was obtained from the patient’s parent for publication of this article and accompanying images.
No potential conflict of interest relevant to this article was reported.
Sequences of primers using polymerase chain reaction reaction
Sense (5’ to 3’) | Antisense (5’ to 3’) | |
---|---|---|
Exon1 | cctgcaaactggtaggcg | cgtgacgtaaagccgaacc |
Exon2 | cccggcctgttgttttctt | aaggccctcctcttttattttt |
Exon3 | caggcatggggtctcactg | tgaaagcaagtatggtttgcag |
Exon4 | agctagctaacttctcaaatcttct | aacctagactgcttccaaggg |
Exon5 | acaggcttccaaatcccag | cctttagaacacaagcccacc |
Exon6 | ttgctgagggccagatgat | tgagctttattaacacatgacaaaa |
Exon7 | aatccccataatttagctctcca | tggcaaatgtgcctctctaca |
Exon8 | tttttgtcaatcatttaaccatc | ctggccaggttccagttct |
Exon9 | ttcaaaagatacactccccaaaa | tttaggaatgcagcaactgaca |
Primers were designed with primer 3 using sequences from GenBank accession number of NG_012329.2.
Summary of dental treatment in Lesch–Nyhan syndrome
Study | Age (yr)/sex | Treatment | Treatment effect |
---|---|---|---|
Dabrowski et al.5 (2005) | 10/M | BTX-A injection in both masseter muscles, a total of 40 units, every 12 weeks | • ↑ Speech articulation • No impact on eating or swallowing |
Cauwels and Martens4 (2005) | 5/M | Combination of a mouthguard in the upper jaw and a lip-bumper in the lower jaw | • Positive behavioral modification |
Gutierrez et al.12 (2008) | 30/M | BTX-A injection in both zygomatic muscles 12.5 IU each, six sites in the lower part of the lip orbicularis muscle of 2.5 IU each, and three injections in the levator labii inferioris of 5 IU each, every 3 months | • ↓ Lip biting and self-mutilating behavior • No side effects |
Arhakis et al.2 (2010) | 14/M | Maxillary acrylic appliance with a posterior occlusal bite plate | • During the 3-year follow up, self-injury behavior disappeared |
Gilbert et al.3 (2021) | 13/M | BoNT injection in both masseter muscles, to a total of 50 units, every 4-6 months | • ↑ Speech articulation • ↓ Self-mutilating behavior • ↑ Feeding |
(M: male, BTX: botulinum toxin, BoNT: bonabotulinum toxin)